WormBase Tree Display for Feature: WBsf919691
expand all nodes | collapse all nodes | view schema
WBsf919691 | SMap | S_parent | Sequence | F01D4 |
---|---|---|---|---|
Name | Public_name | MEC-3 binding site (m3) | ||
Sequence_details | Flanking_sequences | atttggagacaccagttttagcgcacatta | cagggtctagagactcctgttggattggca | |
Mapping_target | F01D4 | |||
DNA_text | ATAATCGAT | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Binding site for MEC-3 transcription factor (m3), within the promoter region of mec-3 | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00001664 | ||
Associations | Associated_with_gene | WBGene00003167 | ||
Associated_with_Interaction | WBInteraction000524070 | |||
WBInteraction000524245 | ||||
Associated_with_transcription_factor | WBTranscriptionFactor000297 | |||
Bound_by_product_of | WBGene00003167 | |||
Method | TF_binding_site |