WormBase Tree Display for Feature: WBsf919688
expand all nodes | collapse all nodes | view schema
| WBsf919688 | SMap | S_parent | Sequence | F01D4 |
|---|---|---|---|---|
| Name | Public_name | MEC-3 binding site (n2) | ||
| Sequence_details | Flanking_sequences | ttcttatgaagctagaaagtgtgtgtaagg | ctaaaaagttgtctagttggaacgggctct | |
| Mapping_target | F01D4 | |||
| DNA_text | ataagca | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Binding site for MEC-3 transcription factor (n2), within the promoter region of mec-3 | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00001664 | ||
| Associations | Associated_with_gene | WBGene00003167 | ||
| Associated_with_Interaction | WBInteraction000524073 | |||
| WBInteraction000524248 | ||||
| Associated_with_transcription_factor | WBTranscriptionFactor000297 | |||
| Bound_by_product_of | WBGene00003167 | |||
| Method | TF_binding_site |
