WormBase Tree Display for Feature: WBsf919636
expand all nodes | collapse all nodes | view schema
| WBsf919636 | SMap | S_parent | Sequence | K11G9 |
|---|---|---|---|---|
| Name | Public_name | GATA binding site (GATA1.1) | ||
| Sequence_details | Flanking_sequences | acgtgaatgttgcaaacaccttgtcaataa | aatcagaaactagagctgtgactgaatcgt | |
| Mapping_target | K11G9 | |||
| DNA_text | ctgataa | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | GATA binding site (GATA1.1) within the promoter region of mtl-1, bound by elt-2 | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00003700 | ||
| Associations | Associated_with_gene | WBGene00003473 | ||
| Associated_with_Interaction | WBInteraction000520237 | |||
| WBInteraction000521692 | ||||
| Associated_with_transcription_factor | WBTranscriptionFactor000728 | |||
| Bound_by_product_of | WBGene00001250 | |||
| Method | TF_binding_site |
