WormBase Tree Display for Feature: WBsf919635
expand all nodes | collapse all nodes | view schema
| WBsf919635 | SMap | S_parent | Sequence | F46C8 |
|---|---|---|---|---|
| Name | Public_name | H1 regulatory site | ||
| Sequence_details | Flanking_sequences | ttcctttttcgcatgtactcatctcttctc | cactccaccttcatccacctttccgttttc | |
| Mapping_target | F46C8 | |||
| DNA_text | gtttggaatcttttcttatctccgataattgggttattgtgtcgataaagactgacctatttaacagata | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | H1 homology region within the promoter region of dpy-7 | ||
| SO_term | SO:0005836 | |||
| Defined_by | Defined_by_paper | WBPaper00002736 | ||
| Associations | Associated_with_gene | WBGene00001069 | ||
| Remark | The H1 homology region is likely to represent the major regulatory site for the dpy-7 gene | Paper_evidence | WBPaper00002736 | |
| Method | regulatory_region |
