WormBase Tree Display for Feature: WBsf919602
expand all nodes | collapse all nodes | view schema
WBsf919602 | SMap | S_parent | Sequence | T18D3 |
---|---|---|---|---|
Name | Public_name | Region 'C' | ||
Sequence_details | Flanking_sequences | taagagtagcaaaatggcaggaagagcacttt | ctaaaatgccgtttcttttctcgtatccccact | |
Mapping_target | T18D3 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | The 'C' region enhancer for myo-2. | ||
SO_term | SO:0000165 | |||
Defined_by | Defined_by_paper | WBPaper00002011 | ||
Associations (4) | ||||
Remark | The 'C' region enhancer for myo-2 driving expression in pharyngeal muscle. [2013-07-23 gw3] | |||
Method | enhancer |