WormBase Tree Display for Feature: WBsf919574
expand all nodes | collapse all nodes | view schema
| WBsf919574 | SMap | S_parent | Sequence | C07H6 |
|---|---|---|---|---|
| Name | Public_name | Region N3 enhancer | ||
| Sequence_details | Flanking_sequences | tcttttgaagtgagtggactggcgcctggtgacta | gtttatgttaaatccaatcgatcgattttt | |
| Mapping_target | C07H6 | |||
| DNA_text | ||||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Region N3 enhancer of ceh-13/lin-39 expressed in embryo to L1, Hyp7 / expressed in L1 to L3, V cells, P cells, ventral cord | ||
| SO_term | SO:0000165 | |||
| Defined_by | Defined_by_paper | WBPaper00032330 | ||
| Associations | Associated_with_gene | WBGene00003024 | ||
| WBGene00000437 | ||||
| Associated_with_expression_pattern | Expr11417 | |||
| Associated_with_construct | WBCnstr00018833 | |||
| Remark | Region N3 expressed in embryo to L1, Hyp7 / expressed in L1 to L3, V cells, P cells, ventral cord. [2013-07-23 gw3] | |||
| Method | enhancer |
