WormBase Tree Display for Feature: WBsf898124
expand all nodes | collapse all nodes | view schema
| WBsf898124 | SMap | S_parent | Sequence | F43D9 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | TCTACGAAGTATATATGGATAACTTTGTTAGGAATCTGTTTTCTGGTTTT | CATAGAAATTGGCTGAAAATTTATTTTTAATTTGATTAAAAAGAAAACGC | |
| Mapping_target | F43D9 | |||
| DNA_text | aactttgttaggaatctgttttctggttttTcatagaaattggctgaaaatttatttttaa | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Possible genome sequence error found in RNASeq analysis of Hawaian strain SNPs by Oliver Hobart with input from Bob Waterston. | ||
| Possible genome sequence error found in RNASeq analysis of N2 and the sister strain LSJ2 from Patrick McGrath. | ||||
| The sequence of the ESTs yk1067d03.3 confirm the suggested change; This overlaps with coding transcript: F43D9.3a F43D9.3b; Match to Variation WBVar00178755 found | ||||
| SNP aactttgttaggaatctgttttctggttttTcatagaaattggctgaaaatttatttttaa | ||||
| Marked for correction | ||||
| Defined_by | Defined_by_paper | WBPaper00037789 | ||
| WBPaper00040097 | ||||
| Remark | This genome error was corrected in WS235. | |||
| Method | Corrected_genome_sequence_error |
