WormBase Tree Display for Feature: WBsf638102
expand all nodes | collapse all nodes | view schema
| WBsf638102 | SMap | S_parent | Sequence | K08H2 | ||
|---|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | tgaactttttatattaaattttttcacatc | attttgttttttcctttaataaattattta | |||
| Mapping_target | K08H2 | |||||
| Source_location | 190 | CHROMOSOME_X | 13246930 | 13246931 | ||
| Origin | Species | Caenorhabditis elegans | ||||
| Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
| polyA site | ||||||
| SO_term | SO:0000553 | |||||
| Defined_by | Defined_by_paper | WBPaper00037808 | ||||
| Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
| Bartel data confident_cleavagesite score: 4.0 | ||||||
| Method | polyA_site |
