WormBase Tree Display for Feature: WBsf621712
expand all nodes | collapse all nodes | view schema
| WBsf621712 | SMap | S_parent | Sequence | K08E7 | ||
|---|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | gttttgttccataaattttgacgatgattt | atctatatgtatttattttcttctatgctt | |||
| Mapping_target | K08E7 | |||||
| Source_location | 190 | CHROMOSOME_IV | 12570592 | 12570593 | ||
| Origin | Species | Caenorhabditis elegans | ||||
| Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
| polyA site | ||||||
| SO_term | SO:0000553 | |||||
| Defined_by | Defined_by_sequence | elegans_PE_SS_GG8244|c2_g1_i1 | Inferred_automatically | make_missing_tsl_features.pl | ||
| elegans_PE_SS_GG8244|c2_g2_i1 | Inferred_automatically | make_missing_tsl_features.pl | ||||
| Defined_by_paper | WBPaper00037808 | |||||
| Associations | Associated_with_transcript | K08E7.3.1 | ||||
| Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
| Bartel data confident_cleavagesite score: 383.0 | ||||||
| Method | polyA_site |
