WormBase Tree Display for Feature: WBsf620611
expand all nodes | collapse all nodes | view schema
WBsf620611 | SMap | S_parent | Sequence | F31E3 | ||
---|---|---|---|---|---|---|
Sequence_details | Flanking_sequences | cgcaccttccacgcccaggtcatcatcatg | aaccatccaggacagatctccaacggatac | |||
Mapping_target | F31E3 | |||||
Source_location | 190 | CHROMOSOME_III | 6970475 | 6970474 | ||
Origin | Species | Caenorhabditis elegans | ||||
Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
polyA site | ||||||
SO_term | SO:0000553 | |||||
Defined_by | Defined_by_paper | WBPaper00037808 | ||||
Defined_by_analysis | adult_pA.10.15.sumCM | |||||
L2_pA.10.15.sumCM | ||||||
Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
Bartel data adult_pA.10.15.sumCM score: 1.0 | ||||||
Bartel data L2_pA.10.15.sumCM score: 1.0 | ||||||
Method | polyA_site |