WormBase Tree Display for Feature: WBsf615826
expand all nodes | collapse all nodes | view schema
WBsf615826 | SMap | S_parent | Sequence | Y66A7AR | ||
---|---|---|---|---|---|---|
Sequence_details | Flanking_sequences | cttttgaaaataaaaattttaaaaaaactc | aaaatatttattaaaatacgttaactaatt | |||
Mapping_target | Y66A7AR | |||||
Source_location | 190 | CHROMOSOME_III | 11628111 | 11628110 | ||
Origin | Species | Caenorhabditis elegans | ||||
Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
polyA site | ||||||
SO_term | SO:0000553 | |||||
Defined_by | Defined_by_sequence | elegans_PE_SS_GG2476|c0_g1_i1 | Inferred_automatically | make_missing_tsl_features.pl | ||
elegans_PE_SS_GG2476|c0_g1_i2 | Inferred_automatically | make_missing_tsl_features.pl | ||||
Defined_by_paper | WBPaper00037808 | |||||
Associations | Associated_with_transcript | Y66A7A.7.1 | ||||
Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
Bartel data confident_cleavagesite score: 5.0 | ||||||
Method | polyA_site |