WormBase Tree Display for Feature: WBsf615617
expand all nodes | collapse all nodes | view schema
WBsf615617 | SMap | S_parent | Sequence | F10E9 | ||
---|---|---|---|---|---|---|
Sequence_details | Flanking_sequences | aattttcaaacaaaaaacattttcaagaat | aacatgacattatcagtgtaataaataaag | |||
Mapping_target | F10E9 | |||||
Source_location | 190 | CHROMOSOME_III | 8305695 | 8305694 | ||
Origin | Species | Caenorhabditis elegans | ||||
Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
polyA site | ||||||
SO_term | SO:0000553 | |||||
Defined_by | Defined_by_paper | WBPaper00037808 | ||||
Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
Bartel data confident_cleavagesite score: 9.0 | ||||||
Method | polyA_site |