WormBase Tree Display for Feature: WBsf267464
expand all nodes | collapse all nodes | view schema
WBsf267464 | SMap | S_parent | Sequence | ZK1055 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | ATTTTGAAGAACTTCAAGCCGATCTTGCCA | GAAGAAATGCAATCAACTCAAGCTGATGCT | |
Mapping_target | ZK1055 | |||
Origin | Species | Caenorhabditis elegans | ||
Defined_by | Defined_by_paper | WBPaper00032940 | ||
Defined_by_analysis | Dnase1_240_480 | |||
Remark | [110912 gw3] A hypersensitive site is a short region of chromatin and is detected by its super sensitivity to cleavage by DNase I. In a hypersensitive site, the nucleosomal structure is not organized in the usual fashion, which results in a 100 fold increase in sensitivity to enzyme attack than in bulk chromatin. | |||
[171114 gw3] This DNase hypersensitivity site has been retired because the sites found by Maggie Ho are more accurate. | ||||
Method | DNaseI_hypersensitive_site |