WormBase Tree Display for Feature: WBsf246836
expand all nodes | collapse all nodes | view schema
| WBsf246836 | SMap | S_parent | Sequence | ZK637 | ||
|---|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | CACTAACCGTTGAATAAATAAGTTGATTGC | AAACAAAGTGGAATCGCTAGCTCCATGACA | |||
| Mapping_target | ZK637 | |||||
| Source_location | 190 | CHROMOSOME_III | 8911657 | 8911658 | ||
| Origin | Species | Caenorhabditis elegans | ||||
| Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
| polyA site | ||||||
| SO_term | SO:0000553 | |||||
| Defined_by | Defined_by_sequence | elegans_PE_SS_GG6863|c8_g1_i3 | Inferred_automatically | make_missing_tsl_features.pl | ||
| elegans_PE_SS_GG6863|c8_g1_i4 | Inferred_automatically | make_missing_tsl_features.pl | ||||
| elegans_PE_SS_GG6863|c8_g1_i5 | Inferred_automatically | make_missing_tsl_features.pl | ||||
| Defined_by_paper | WBPaper00037808 | |||||
| WBPaper00037948 | ||||||
| Defined_by_analysis | RNASeq_Fire.all_stages_ssRNALigSeq | |||||
| Associations | Associated_with_transcript | ZK637.8a.1 | ||||
| ZK637.8c.1 | ||||||
| ZK637.8f.1 | ||||||
| Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
| Bartel data confident_cleavagesite score: 2904.0 | ||||||
| Method | polyA_site |
