WormBase Tree Display for Feature: WBsf246674
expand all nodes | collapse all nodes | view schema
WBsf246674 | SMap | S_parent | Sequence | C29E4 | ||
---|---|---|---|---|---|---|
Sequence_details | Flanking_sequences | TTGAACAATTGAAATAAAACACTGGGAAGG | AAAATAGGCAATTACGATGAGGAAAACACA | |||
Mapping_target | C29E4 | |||||
Source_location | 190 | CHROMOSOME_III | 7949997 | 7949998 | ||
Origin | Species | Caenorhabditis elegans | ||||
Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
polyA site | ||||||
SO_term | SO:0000553 | |||||
Defined_by | Defined_by_sequence | elegans_PE_SS_GG6643|c9_g1_i1 | Inferred_automatically | make_missing_tsl_features.pl | ||
Defined_by_paper | WBPaper00037808 | |||||
WBPaper00037948 | ||||||
Defined_by_analysis | RNASeq_Fire.all_stages_ssRNALigSeq | |||||
Associations | Associated_with_transcript | C29E4.1.1 | ||||
Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
Bartel data confident_cleavagesite score: 122.0 | ||||||
Method | polyA_site |