WormBase Tree Display for Feature: WBsf246117
expand all nodes | collapse all nodes | view schema
| WBsf246117 | SMap | S_parent | Sequence | ZC155 | ||
|---|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | TATTTTTTGAATAAACCGGGTATTTTATTG | ATTTCTCTAGTTCAATCAATGAAATTCTAA | |||
| Mapping_target | ZC155 | |||||
| Source_location | 190 | CHROMOSOME_III | 5207526 | 5207525 | ||
| Origin | Species | Caenorhabditis elegans | ||||
| Visible | Description | This polyA_site feature was defined by the Bartel paper. | ||||
| polyA site | ||||||
| SO_term | SO:0000553 | |||||
| Defined_by | Defined_by_sequence | elegans_PE_SS_GG2713|c1_g2_i1 | Inferred_automatically | make_missing_tsl_features.pl | ||
| elegans_PE_SS_GG2713|c1_g2_i2 | Inferred_automatically | make_missing_tsl_features.pl | ||||
| Defined_by_paper | WBPaper00037808 | |||||
| Associations | Associated_with_transcript | ZC155.7.1 | ||||
| ZC155.7.2 | ||||||
| Remark | [110125 gw3] This polyA_site feature was defined by the Bartel paper. | |||||
| Bartel data confident_cleavagesite score: 424.0 | ||||||
| Method | polyA_site |
