WormBase Tree Display for Feature: WBsf142088
expand all nodes | collapse all nodes | view schema
WBsf142088 | SMap | S_parent | Sequence | F26A3 |
---|---|---|---|---|
Sequence_details | Flanking_sequences | AATGTTGAAATTGTAATATTTTTCTTACAG | ACCATCTACCTCAAAACGATTTTAGCCTAA | |
Mapping_target | F26A3 | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | SL2 defined by RNASeq short reads (Hillier et al.) | ||
Defined_by | Defined_by_sequence | mid-L2_20dC_14hrs_post-L1_bundle_of_reads_supporting_SL13_I_7656330_7656331_-_wb170 | ||
mid-L4_20dC_36hrs_post-L1_bundle_of_reads_supporting_SL4_I_7656330_7656331_-_wb170 | ||||
Defined_by_analysis | RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 | 1 | ||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 | 1 | |||
RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103987 | 1 | |||
Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 1 reads | |||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 1 reads | ||||
Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103987 with 1 reads | ||||
Method | SL2 |