WormBase Tree Display for Feature: WBsf132956
expand all nodes | collapse all nodes | view schema
| WBsf132956 | SMap | S_parent | Sequence | Y18H1A |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | TTCAAGTCAAAACTCGTGTTTTTTTTTCAG | AAAACTTCAAGGAATCAAAGTCACTGAACG | |
| Mapping_target | Y18H1A | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
| Defined_by | Defined_by_sequence | Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_SL1_I_718367_718368_-_wb170 | ||
| mid-L1_20dC_4hrs_post-L1_bundle_of_reads_supporting_SL1_I_718367_718368_-_wb170 | ||||
| Defined_by_analysis | RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 | 1 | ||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 | 1 | |||
| RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036882 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047635 | 1 | |||
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092480 | 1 | |||
| Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 with 1 reads | |||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036882 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047635 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092480 with 1 reads | ||||
| Method | SL1 |
