WormBase Tree Display for Feature: WBsf126800
expand all nodes | collapse all nodes | view schema
| WBsf126800 | SMap | S_parent | Sequence | T21C12 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | TTGCCTTACTTTTAAAACTAACTTTTGCAG | AATGAGGATGCAGTGCCGAATGAACTAACT | |
| Mapping_target | T21C12 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
| Defined_by | Defined_by_sequence | dauer_exit_daf-2_25dC_91hrs_15dC_12hrs_post-L1_bundle_of_reads_supporting_sl1_III_10527272_10527273_+_wb170 | ||
| dauer_exit_daf-2_25dC_91hrs_15dC_12hrs_post-L1_bundle_of_reads_supporting_SL1_III_10527271_10527272_+_wb170 | ||||
| late_embryo_20dC_4.5hrs_post-early_embryo_bundle_of_reads_supporting_SL1_III_10527271_10527272_+_wb170 | ||||
| Defined_by_analysis | RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008140 | 1 | ||
| RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 | 1 | |||
| RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0005409.PRJNA33023.SRX139567 | 1 | |||
| RNASeq.elegans.N2.WBls:0000008.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145480 | 1 | |||
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145660 | 1 | |||
| RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX151607 | 2 | |||
| Remark | Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008140 with 1 reads | |||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0005409.PRJNA33023.SRX139567 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000008.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145480 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145660 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX151607 with 2 reads | ||||
| Method | SL1 |
