WormBase Tree Display for Feature: WBsf047660
expand all nodes | collapse all nodes | view schema
| WBsf047660 | SMap | S_parent | Sequence | Y73C8B |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | atgaaacatttgcaatactttgaaatttgtg | ttatttaggacagttattagtttaccttaaa | |
| Mapping_target | Y73C8B | |||
| DNA_text | tgattcat | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | Putative transcription factor binding site | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00028766 | ||
| Associations | Associated_with_gene | WBGene00002246 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000009 | |||
| Bound_by_product_of | WBGene00003024 | |||
| Remark | One of two sites in which LIN-39 protein was shown to interact with the lag-2 promoter in vivo (ChIP). | |||
| Method | TF_binding_site |
