WormBase Tree Display for Feature: WBsf047645
expand all nodes | collapse all nodes | view schema
| WBsf047645 | SMap | S_parent | Sequence | T18D3 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | gtactcattgttctggataaaattctctcgt | cgtcggatgtctgcctctctgcattgagccg | |
| Mapping_target | T18D3 | |||
| DNA_text | TGTTTGC | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | A high-affinity binding site | ||
| SO_term | SO:0000235 | |||
| Defined_by | Defined_by_paper | WBPaper00028549 | ||
| Associations | Associated_with_gene | WBGene00003514 | ||
| Associated_with_transcription_factor | WBTranscriptionFactor000020 | |||
| Bound_by_product_of | WBGene00004013 | |||
| Remark | The activation of pharyngeal genes by PHA-4 may depend on its ability to recruit HTZ-1. | |||
| Method | TF_binding_site |
