WormBase Tree Display for Feature: WBsf038800
expand all nodes | collapse all nodes | view schema
WBsf038800 | SMap | S_parent | Sequence | Y73C8B |
---|---|---|---|---|
Sequence_details | Flanking_sequences | gtttccggttcggcctgaaacaagaataaca | ctcgataactgttaggaaaataaattttttg | |
Mapping_target | Y73C8B | |||
DNA_text | ACAGGTGA | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | E-box site | ||
SO_term | SO:0001158 | |||
Defined_by | Defined_by_paper | WBPaper00033102 | ||
Associations | Associated_with_gene | WBGene00002246 | ||
Associated_with_transcription_factor | WBTranscriptionFactor000063 | |||
Bound_by_product_of | WBGene00001949 | |||
Remark | The 3.3 kb lag-2 promoter region upstream from the translational start codon contains six predicted E-box sites. | Paper_evidence | WBPaper00033102 | |
Method | TF_binding_site |