WormBase Tree Display for Feature: WBsf038790
expand all nodes | collapse all nodes | view schema
| WBsf038790 | SMap | S_parent | Sequence | F55A8 | |
|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | gggggggggggggggggcgaacaaaggaaag | ccccgggaggcggcgttcgcttttgaaaatc | ||
| Mapping_target | F55A8 | ||||
| DNA_text | TGATATAT | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | Transcription factor binding site | |||
| SO_term | SO:0000235 | ||||
| Defined_by | Defined_by_paper | WBPaper00005609 | Person_evidence | WBPerson9133 | |
| Associations | Associated_with_gene | WBGene00001186 | |||
| Associated_with_Interaction | WBInteraction000521977 | ||||
| WBInteraction000524264 | |||||
| Associated_with_transcription_factor | WBTranscriptionFactor000095 | ||||
| Bound_by_product_of | WBGene00003024 | ||||
| WBGene00000443 | |||||
| Remark | [090818 md9] Experimental evidence shows this site is important in the vulval-specific expression of egl-18/elt-6 | Paper_evidence | WBPaper00005609 | ||
| LIN-39/CEH-20 dimers bind Hox/PBC sites in the egl18/elt-6 vulval enhancer. | |||||
| Method | TF_binding_site |
