WormBase Tree Display for Feature: WBsf028067
expand all nodes | collapse all nodes | view schema
WBsf028067 | SMap | S_parent | Sequence | Y73C8B |
---|---|---|---|---|
Sequence_details | Flanking_sequences | cagtcctaaacggaattttttgcattcttt | caaatgttcactctaactaattcaaaaatc | |
Mapping_target | Y73C8B | |||
DNA_text | tgcttctttacaattt | |||
Origin | Species | Caenorhabditis elegans | ||
Visible | Description | Forkhead-binding site A | ||
SO_term | SO:0000235 | |||
Defined_by | Defined_by_paper | WBPaper00031997 | ||
Associations | Associated_with_gene | WBGene00002246 | ||
Associated_with_transcription_factor | WBTranscriptionFactor000007 | |||
Bound_by_product_of | WBGene00006853 | |||
Remark | TTAC within the binding site represents the core binding site | Paper_evidence | WBPaper00031997 | |
Method | TF_binding_site |