WormBase Tree Display for Feature: WBsf019585
expand all nodes | collapse all nodes | view schema
| WBsf019585 | SMap | S_parent | Sequence | F58D12 | |
|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | GTATACCTACCTACATCAGGCGGTTTTCAG | GATTTTTGCTTCAAAACGGCTTCCTCGTCT | ||
| Mapping_target | F58D12 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | SL1 trans-splice leader acceptor site | |||
| SO_term | SO:0000706 | ||||
| Defined_by | Defined_by_sequence | yk1412c02.5 | Curator_confirmed | WBPerson1846 | |
| Inferred_automatically | make_missing_tsl_features.pl | ||||
| Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_sl1_V_14057647_14057648_+_wb170 | |||||
| Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_SL1_V_14057646_14057647_+_wb170 | |||||
| mid-L1_20dC_4hrs_post-L1_bundle_of_reads_supporting_SL1_V_14057646_14057647_+_wb170 | |||||
| Defined_by_analysis | RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 | 1 | |||
| RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014010 | 1 | ||||
| RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX151607 | 2 | ||||
| Associations | Associated_with_gene | WBGene00010250 | |||
| Associated_with_CDS | F58D12.3 | ||||
| Associated_with_transcript | F58D12.3.1 | ||||
| Remark | Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014010 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX151607 with 2 reads | |||||
| Method | SL1 |
