WormBase Tree Display for Feature: WBsf007016
expand all nodes | collapse all nodes | view schema
| WBsf007016 | SMap | S_parent | Sequence | C31H5 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | TCAATTTTCTCAATTCACATTTTCTTTCAG | CAACTCTCAATGCCACGCCACCAAGGTCGA | |
| Mapping_target | C31H5 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_sequence (16) | |||
| Defined_by_analysis | TEC-RED | |||
| RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001872 | 1 | |||
| RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 | 2 | |||
| RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 | 3 | |||
| RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036882 | 1 | |||
| RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 | 1 | |||
| RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 | 1 | |||
| RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 | 2 | |||
| RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139602 | 1 | |||
| Associations | Associated_with_CDS | C31H5.3a | ||
| Associated_with_transcript | C31H5.3a.1 | |||
| Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001872 with 1 reads | |||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036882 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139602 with 1 reads | ||||
| Method | SL1 |
