WormBase Tree Display for Feature: WBsf000074
expand all nodes | collapse all nodes | view schema
| WBsf000074 | SMap | S_parent | Sequence | ZK1290 | |
|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | CCTCATTTCATGATTTTCTTTGGTTTTTAG | GTAGCATTGCTCTCTTCAATCATATGGATT | ||
| Mapping_target | ZK1290 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| History | Acquires_merge | WBsf004402 | |||
| Visible | Description | SL1 trans-splice leader acceptor site | |||
| SO_term | SO:0000706 | ||||
| Defined_by | Defined_by_sequence | yk1176f10.5 | Curator_confirmed | WBPerson1846 | |
| Inferred_automatically | make_missing_tsl_features.pl | ||||
| AF135186 | Curator_confirmed | WBPerson1846 | |||
| Inferred_automatically | make_missing_tsl_features.pl | ||||
| early_embryo_bundle_of_reads_supporting_SL1_II_7549258_7549259_+_wb170 | |||||
| mid-L1_20dC_4hrs_post-L1_bundle_of_reads_supporting_SL1_II_7549258_7549259_+_wb170 | |||||
| mid-L2_20dC_14hrs_post-L1_bundle_of_reads_supporting_SL1_II_7549258_7549259_+_wb170 | |||||
| mid-L3_20dC_25hrs_post-L1_bundle_of_reads_supporting_SL1_II_7549258_7549259_+_wb170 | |||||
| Defined_by_analysis | RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 | 1 | |||
| RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036881 | 1 | ||||
| RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 | 2 | ||||
| Associations | Associated_with_CDS | ZK1290.2a | |||
| Associated_with_transcript | ZK1290.2a.1 | ||||
| Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036881 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 2 reads | |||||
| Method | SL1 |
