WormBase Tree Display for Feature: WBsf131861
expand all nodes | collapse all nodes | view schema
| WBsf131861 | SMap | S_parent | Sequence | C02C6 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | CATTAATCGACTAAAAAAATCGATTTTCAG | GTAGTTCAGCGTATAACCACCAGGATCAGC | |
| Mapping_target | C02C6 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 defined by RNASeq short reads (Hillier et al.) | ||
| Defined_by | Defined_by_sequence (19) | |||
| Defined_by_paper | WBPaper00037948 | |||
| Defined_by_analysis (86) | ||||
| Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001872 with 14 reads | |||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001873 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001874 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 with 7 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004864 with 12 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 with 15 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX004868 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 9 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 43 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000032.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008138 with 8 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008139 with 19 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008140 with 7 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 with 18 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 32 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 48 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 13 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 32 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014010 with 17 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA51225.SRX026728 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA51225.SRX026729 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000002.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028190 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000002.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028191 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX035162 with 36 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036881 with 19 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036882 with 13 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 with 26 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 with 42 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 with 36 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037186 with 30 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 56 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037199 with 9 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 65 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 with 75 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 with 35 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 37 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047635 with 10 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047653 with 16 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047787 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049269 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049270 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX049745 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085111 with 7 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085112 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085217 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085218 with 9 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 45 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085287 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092371 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092372 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092477 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092478 with 18 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092479 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092480 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX099902 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX099915 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103988 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103989 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103990 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139566 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0005409.PRJNA33023.SRX139567 with 10 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139591 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0005409.PRJNA33023.SRX139592 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139602 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0005409.PRJNA33023.SRX139603 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0003679.PRJNA33023.SRX145443 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145444 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.LX837.WBls:0000024.Hermaphrodite.WBbt:0003666.PRJNA33023.SRX145445 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0003679.PRJNA33023.SRX145446 with 11 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 with 26 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000008.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145480 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 with 52 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145660 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145661 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.DZ685.WBls:0000003.Hermaphrodite.WBbt:0008378.PRJNA33023.SRX151598 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.NW1229.WBls:0000024.Hermaphrodite.WBbt:0003679.PRJNA33023.SRX151599 with 12 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.NW1229.WBls:0000024.Hermaphrodite.WBbt:0003679.PRJNA33023.SRX151602 with 12 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX151607 with 71 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.LX837.WBls:0000024.Hermaphrodite.WBbt:0003666.PRJNA33023.SRX151617 with 26 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0005175.PRJNA33023.SRX151618 with 14 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.NW1229.WBls:0000024.Hermaphrodite.WBbt:0003679.PRJNA33023.SRX190366 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.SRP016006.SRX191947 with 4 reads | ||||
| Method | SL1 |
