WormBase Tree Display for Feature: WBsf002192
expand all nodes | collapse all nodes | view schema
| WBsf002192 | SMap | S_parent | Sequence | F40F9 |
|---|---|---|---|---|
| Sequence_details | Flanking_sequences | TTTCGTTTCAATAATATTATTTAATTCCAG | ATATGTCGTACAATCAACAGCCATACAACC | |
| Mapping_target | F40F9 | |||
| Origin | Species | Caenorhabditis elegans | ||
| Visible | Description | SL1 trans-splice leader acceptor site | ||
| SO_term | SO:0000706 | |||
| Defined_by | Defined_by_sequence (22) | |||
| Defined_by_paper | WBPaper00037948 | |||
| Defined_by_analysis (90) | ||||
| Associations | Associated_with_CDS | F40F9.1a | ||
| Associated_with_transcript | F40F9.1a.1 | |||
| Remark | Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001872 with 10 reads | |||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001873 with 28 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001874 with 10 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX001875 with 8 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004864 with 50 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004866 with 46 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX004868 with 38 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 49 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 102 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000032.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008138 with 54 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008139 with 31 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008140 with 32 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 with 17 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 with 75 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 124 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 139 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014008 with 57 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014009 with 89 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014010 with 69 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA51225.SRX026729 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000002.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028190 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.BA17.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028193 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028201 with 9 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028202 with 7 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA128465.SRX028203 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX035162 with 46 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000035.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036881 with 22 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036882 with 29 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036967 with 40 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036969 with 62 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX036970 with 52 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037186 with 59 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037197 with 21 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 164 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000052.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037199 with 24 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.JK1107.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037200 with 49 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 106 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 with 97 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 with 104 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 63 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047635 with 28 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047653 with 17 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047787 with 29 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049744 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX049745 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX050610 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX050630 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085111 with 94 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085112 with 20 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085217 with 26 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085218 with 94 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085220 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 67 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085287 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092371 with 28 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092372 with 67 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092477 with 29 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092478 with 214 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092479 with 58 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX092480 with 38 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX099901 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX099902 with 8 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX099907 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX099908 with 20 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX099915 with 148 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103986 with 14 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103987 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103988 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX103989 with 20 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139566 with 10 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0005409.PRJNA33023.SRX139567 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX139591 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0005409.PRJNA33023.SRX139603 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0003679.PRJNA33023.SRX145443 with 11 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145444 with 43 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0003679.PRJNA33023.SRX145446 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145447 with 83 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000008.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145480 with 3 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 with 49 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145660 with 11 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145661 with 8 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.DZ685.WBls:0000003.Hermaphrodite.WBbt:0008378.PRJNA33023.SRX151598 with 2 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.NW1229.WBls:0000024.Hermaphrodite.WBbt:0003679.PRJNA33023.SRX151599 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.NW1229.WBls:0000024.Hermaphrodite.WBbt:0003679.PRJNA33023.SRX151602 with 4 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000027.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX151607 with 50 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0005175.PRJNA33023.SRX151618 with 14 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Hermaphrodite.WBbt:0007833.SRP016006.SRX191947 with 6 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Male.WBbt:0007833.SRP016006.SRX191950 with 5 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000041.Male.WBbt:0007833.SRP016006.SRX191952 with 1 reads | ||||
| Method | SL1 |
