WormBase Tree Display for Feature: WBsf002073
expand all nodes | collapse all nodes | view schema
| WBsf002073 | SMap | S_parent | Sequence | H06O01 | |
|---|---|---|---|---|---|
| Sequence_details | Flanking_sequences | TGTGATGACACCTGCAATTCTTTTCCTTAG | GCTGTTTCTCGTTCCTCACCAACGATTGAA | ||
| Mapping_target | H06O01 | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Visible | Description | SL1 trans-splice leader acceptor site | |||
| SO_term | SO:0000706 | ||||
| Defined_by | Defined_by_sequence | yk1081g01.5 | Curator_confirmed | WBPerson1846 | |
| Inferred_automatically | make_missing_tsl_features.pl | ||||
| Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_sl1_I_7005442_7005443_+_wb170 | |||||
| Adult_spe-9_23dC_8days_post-L4_molt_bundle_of_reads_supporting_SL1_I_7005441_7005442_+_wb170 | |||||
| dauer_entry_daf-2_25dC_48hrs_post-L1_bundle_of_reads_supporting_SL1_I_7005441_7005442_+_wb170 | |||||
| early_embryo_bundle_of_reads_supporting_SL1_I_7005441_7005442_+_wb170 | |||||
| embryo_him-8_20dC_post-L1_bundle_of_reads_supporting_SL1_I_7005441_7005442_+_wb170 | |||||
| late_embryo_20dC_4.5hrs_post-early_embryo_bundle_of_reads_supporting_SL1_I_7005441_7005442_+_wb170 | |||||
| lin-35_n745_mid-L1_25dC_4.0hrs_post-L1_bundle_of_reads_supporting_SL1_I_7005441_7005442_+_wb170 | |||||
| Defined_by_analysis (16) | |||||
| Associations | Associated_with_CDS | H06O01.3a | |||
| Associated_with_transcript | H06O01.3a.1 | ||||
| Remark | Defined by RNASeq data from RNASeq.elegans.MT10430.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX004869 with 1 reads | ||||
| Defined by RNASeq data from RNASeq.elegans.BA671.WBls:0000041.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008136 with 2 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX008144 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX011569 with 2 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014006 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000063.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX014007 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037186 with 2 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.CB1489.WBls:0000003.Male.WBbt:0007833.PRJNA33023.SRX037198 with 3 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000024.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX037288 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047446 with 3 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.CB4689.WBls:0000038.Male.WBbt:0007833.PRJNA33023.SRX047469 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.CB1370.WBls:0000031.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX047470 with 2 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000038.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX049268 with 1 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000010.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX085218 with 3 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000021.Hermaphrodite.WBbt:0005451.PRJNA33023.SRX085286 with 2 reads | |||||
| Defined by RNASeq data from RNASeq.elegans.N2.WBls:0000004.Hermaphrodite.WBbt:0007833.PRJNA33023.SRX145486 with 1 reads | |||||
| Method | SL1 |
