WormBase Tree Display for Expr_pattern: Expr9554
expand all nodes | collapse all nodes | view schema
Expr9554 | Expression_of | Gene | WBGene00011017 | |
---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00011017 | |||
Expression_data | Life_stage | WBls:0000041 | ||
WBls:0000023 | ||||
Anatomy_term | WBbt:0003681 | Certain | ||
WBbt:0004292 | Certain | |||
WBbt:0005175 | Certain | |||
WBbt:0005319 | Certain | |||
WBbt:0005767 | Certain | |||
WBbt:0005813 | Certain | |||
WBbt:0006748 | Certain | |||
WBbt:0006751 | Certain | |||
GO_term | GO:0005783 | |||
Subcellular_localization | Sub-cellular localization within the body wall muscle: Endoplasmic reticulum (ER) +/- Other | |||
Type | Reporter_gene | The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http://www.addgene.org/pgvec1?f=3Dc&cmd=3Dshowcol&colid=3D 1) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70=961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1 ::ORF::GFP expression clones. | ||
Pattern | Adult Expression: pharynx; pharyngeal-intestinal valve; anal depressor muscle; Reproductive System; spermatheca; body wall muscle; Nervous System; head neurons. | |||
Larval Expression: pharynx; pharyngeal-intestinal valve; anal depressor muscle; Reproductive System; developing gonad; developing vulva; developing spermatheca; body wall muscle; Nervous System; head neurons; | ||||
Remark | Operon: CEOP5344 | |||
Reference | WBPaper00038444 | |||
Transgene | WBTransgene00014479 |