WormBase Tree Display for Expr_pattern: Expr9061
expand all nodes | collapse all nodes | view schema
| Expr9061 | Expression_of | Gene | WBGene00004206 | |
|---|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00004206 | |||
| Expression_data | Anatomy_term | WBbt:0003933 | Certain | |
| WBbt:0003935 | Certain | |||
| WBbt:0005733 | Uncertain | |||
| WBbt:0005753 | Certain | |||
| Type | Reporter_gene | |||
| Pattern | In animals that carried the pst-1ab(fl)::egfp, pst-1c(fl)::egfp, and Ppst-1bc::egfp vectors, GFP fluorescence was specifically observed in seam cells and amphid sheath cells during embryonic and larval development. GFP expression was also detected in the hypodermis of L4 transgenic animals that carried pst-1ab(fl)::egfp and pst-1c(fl)::egfp. No vulval expression was observed in these transgenic worms. | |||
| Picture | WBPicture0000008362 | |||
| Remark | In transgenic animals that carried Ppst-1a::egfp (translational fusion, forward primer 5- ACTGTTTCGTGGCAAGATCA 3, reverse primer 5- CATGATTGCTCTGAATACCTGG 3), GFP fluorescence was observed in almost all cells throughout development, except germ cells, where extrachromosomal transgenes are generally silenced . The pst-1ab(fl)::egfp and pst-1c(fl)::egfp constructs included the entire sequence of pst-1a, but Ppst-1a::egfp only carried the 5 promoter region of pst-1a; thus, broad expression of Ppst-1a::egfp might be induced due to the absence of a regulatory region for transgene expression. Additionally, the expression pattern induced by a promoter of the M03F8.3 gene, a gene immediately upstream of pst-1, was similar to that induced by the pst-1a promoter (sEx10297). Expression data from a genome-wide in situ hybridization analysis indicated that pst-1 mRNA was specifically expressed in lateral seam cells. | |||
| Picture: Fig 6A to 6D. | ||||
| Reference | WBPaper00036358 | |||
| Transgene | WBTransgene00030880 |
