Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00020952

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00020952Summary[Plin-26::ced-10(Q61L/CA)::smg sensitive 3'UTR]
Driven_by_geneWBGene00003012
GeneWBGene00000424
Other_reportersmg sensitive 3'UTR
Construction_summaryThe wild-type ced-10 sequence was amplified from pPR37 (Reddien and Horvitz, 2000) using primers 5'AAAAAAAAggccggcctggcATGCAAGCGATCAAATGTGTCGTCG 3' and 5'TTTTTTatcgatTTAGAGCACCGTACACTTGCTCTTTTTGG 3' and cloned into pCM1.3 using FseI/ClaI to generate pCM3.2. To make ced-10(Q61L/CA) (pCM3.3), we used PCR site-directed mutagenesis, with pCM3.2 as template and the following primers: ced-10(Q61L/CA) - Forward: 5'GGGATACAGCTGGACTGGAAGATTACGATCGAC 3' Reverse: 5'GTCGATCGTAATCTTCCAGTCCAGCTGTATCCC 3'.
Used_forTransgene_constructWBTransgene00021334
ReferenceWBPaper00048569