WormBase Tree Display for Construct: WBCnstr00020952
expand all nodes | collapse all nodes | view schema
WBCnstr00020952 | Summary | [Plin-26::ced-10(Q61L/CA)::smg sensitive 3'UTR] | |
---|---|---|---|
Driven_by_gene | WBGene00003012 | ||
Gene | WBGene00000424 | ||
Other_reporter | smg sensitive 3'UTR | ||
Construction_summary | The wild-type ced-10 sequence was amplified from pPR37 (Reddien and Horvitz, 2000) using primers 5'AAAAAAAAggccggcctggcATGCAAGCGATCAAATGTGTCGTCG 3' and 5'TTTTTTatcgatTTAGAGCACCGTACACTTGCTCTTTTTGG 3' and cloned into pCM1.3 using FseI/ClaI to generate pCM3.2. To make ced-10(Q61L/CA) (pCM3.3), we used PCR site-directed mutagenesis, with pCM3.2 as template and the following primers: ced-10(Q61L/CA) - Forward: 5'GGGATACAGCTGGACTGGAAGATTACGATCGAC 3' Reverse: 5'GTCGATCGTAATCTTCCAGTCCAGCTGTATCCC 3'. | ||
Used_for | Transgene_construct | WBTransgene00021334 | |
Reference | WBPaper00048569 |