Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00020742

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00020742Summary[Pchw-1::GFP]
Driven_by_geneWBGene00009059
Fusion_reporterGFP
Construction_summaryThe chw-1 promoter plasmid was constructed by PCR amplification and subcloning of chw-1 promoter sequences. We attempted to use primers within the F22E12.3 gene upstream of chw-1, but resulting constructs caused lethality, preventing isolation of transgenes. Instead we used primers VM59 (forward) TCGAGTATTTCGAACCGTTACTGGTGGAGG (with Xma Isite) and DJR412 (reverse) TCGAAGTTTTTCCAACTGCC (with Xma I site) to amplify promoter sequences not including F22E12.3 coding sequences, and subcloned the resulting product into plasmid pPD95.67, which contains GFP and an unc-54 3'UTR (A. Fire, personal communication).
Used_forTransgene_constructWBTransgene00021124
ReferenceWBPaper00047137