WormBase Tree Display for Construct: WBCnstr00020742
expand all nodes | collapse all nodes | view schema
WBCnstr00020742 | Summary | [Pchw-1::GFP] | |
---|---|---|---|
Driven_by_gene | WBGene00009059 | ||
Fusion_reporter | GFP | ||
Construction_summary | The chw-1 promoter plasmid was constructed by PCR amplification and subcloning of chw-1 promoter sequences. We attempted to use primers within the F22E12.3 gene upstream of chw-1, but resulting constructs caused lethality, preventing isolation of transgenes. Instead we used primers VM59 (forward) TCGAGTATTTCGAACCGTTACTGGTGGAGG (with Xma Isite) and DJR412 (reverse) TCGAAGTTTTTCCAACTGCC (with Xma I site) to amplify promoter sequences not including F22E12.3 coding sequences, and subcloned the resulting product into plasmid pPD95.67, which contains GFP and an unc-54 3'UTR (A. Fire, personal communication). | ||
Used_for | Transgene_construct | WBTransgene00021124 | |
Reference | WBPaper00047137 |