WormBase Tree Display for Construct: WBCnstr00018528
expand all nodes | collapse all nodes | view schema
WBCnstr00018528 | Other_name | Expr11270_Ex | |
---|---|---|---|
Summary | [RSD-2A::GFP; RSD-2B::GFP] | ||
Driven_by_gene | WBGene00002957 | ||
Gene | WBGene00004681 | ||
Fusion_reporter | GFP | ||
Construction_summary | GFP sequences were amplified from plasmid L2911(pPD103.87) and inserted behind the let-858 5'-UTR in frame with the downstream RSD-2A sequence in pLT542 to generate plasmid pLT544. An identical strategy was used to generate pLT545 using pLT543 as vector to produce an N-terminal GFP-tagged version of RSD-2B. pLT546 and pLT547 harbor RSD-2 sequences with GFP tags at the C-terminus. Primer 682 (TATATAGCTAGCATGTTCCCGTACTTTTCGTA) was used in RT-PCR reactions. Primer 680 (TATATATCTAGAATGTCCTCCTGCCGAGTA) was used to generate rsd-2a cDNA; and primer 681 (TATATATCTAGAATGAGCGATTCACAAGTG) was used to produce rsd-2b cDNA. | ||
Used_for | Transgene_construct | WBTransgene00019182 | |
Reference | WBPaper00044261 |