Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00018528

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00018528Other_nameExpr11270_Ex
Summary[RSD-2A::GFP; RSD-2B::GFP]
Driven_by_geneWBGene00002957
GeneWBGene00004681
Fusion_reporterGFP
Construction_summaryGFP sequences were amplified from plasmid L2911(pPD103.87) and inserted behind the let-858 5'-UTR in frame with the downstream RSD-2A sequence in pLT542 to generate plasmid pLT544. An identical strategy was used to generate pLT545 using pLT543 as vector to produce an N-terminal GFP-tagged version of RSD-2B. pLT546 and pLT547 harbor RSD-2 sequences with GFP tags at the C-terminus. Primer 682 (TATATAGCTAGCATGTTCCCGTACTTTTCGTA) was used in RT-PCR reactions. Primer 680 (TATATATCTAGAATGTCCTCCTGCCGAGTA) was used to generate rsd-2a cDNA; and primer 681 (TATATATCTAGAATGAGCGATTCACAAGTG) was used to produce rsd-2b cDNA.
Used_forTransgene_constructWBTransgene00019182
ReferenceWBPaper00044261