WormBase Tree Display for Construct: WBCnstr00014343
expand all nodes | collapse all nodes | view schema
WBCnstr00014343 | Public_name | fUL#HC111 | |
---|---|---|---|
Other_name | Expr9823_Ex | ||
Summary | [F54H5.4::GFP; pRF4] | ||
Driven_by_gene | WBGene00003480 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | Clone = fUL#HC111. The reporter gene fusion assayed was made by recombineering WRM0640bE10. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: ggtttgatttcattatacagtatcaatctggagtcgatccattcgaagaa, aaaacactcacttcttcatatcttggaggtgcactttgttccattttcag. gfp was inserted immediately after start codon of klf-3b. Other strain: UL4027. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00031268 | |
Reference | WBPaper00040230 | ||
Person | WBPerson266 |