WormBase Tree Display for Construct: WBCnstr00014291
expand all nodes | collapse all nodes | view schema
WBCnstr00014291 | Public_name | fUL#JW84 | |
---|---|---|---|
Other_name | Expr9771_Ex | ||
Summary | [T09A12.4::GFP; pRF4] | ||
Driven_by_gene | WBGene00003656 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | Clone = fUL#JW84. The reporter gene fusion assayed was made by recombineering WRM0634bB10. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: ttccaccaccatcaccattaacatcgctgccacaaaagcccgcccctttg, tgatgctgctgtcgattctgttgatctacagttgtgacatgacctgatgg. gfp was inserted immediately after the nhr-66a start codon. Upstream primer contains 1 extra adenine at the 3' end of upstream homology arm, directly upstream of gfp, to shift the translational reading frame and stop any reporter expression arising from other transcripts with upstream exons spliced onto the exon targeted in this fusion. Other strains: UL3532, UL3533. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00031216 | |
Reference | WBPaper00040230 | ||
Person | WBPerson266 |