WormBase Tree Display for Construct: WBCnstr00014220
expand all nodes | collapse all nodes | view schema
| WBCnstr00014220 | Other_name | Expr9677_Ex | |
|---|---|---|---|
| Summary | [pas-5::GFP] | ||
| Driven_by_gene | WBGene00003926 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | [pas-5::GFP] transcriptional fusion. 1,245 bp of the pas-5 upstream sequence were amplified from wild-type N2 genomic DNA using the primers F_pas5p: 5' CTCAGCTGTCTCGGCTCTCT, and R_pas5p: 5' GGAAGATGACTGGCTGAAATG. The PCR product was fused to GFP and to the 3' UTR of unc-54 (pPD95.75 A. Fire), and cloned into pAD010 vector containing the unc-119 gene (Margalit et al. 2007) by replacing the baf-1 promoter region. --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031155 | |
| Reference | WBPaper00040206 |
