WormBase Tree Display for Construct: WBCnstr00014118
expand all nodes | collapse all nodes | view schema
| WBCnstr00014118 | Other_name | Expr9553_Ex | |
|---|---|---|---|
| [pBX; rol-6; pDM1039 M176.4 (II-C11)ORF::GFP] | |||
| Summary | [M176.4::GFP + pha-1(+) + rol-6] | ||
| Driven_by_gene | WBGene00011498 | ||
| Gene | WBGene00010943 | ||
| Fusion_reporter | GFP | ||
| Construction_summary | The Gateway destination vector (pDM#834) was constructed as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 (Fire LabVector Kit available at http: | ||
| Used_for | Transgene_construct | WBTransgene00014478 | |
| Reference | WBPaper00038444 |
