Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00014016

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00014016Public_namepDM934
Other_nameExpr9451_Ex
[K04G2.9::GFP; pha-1(+); rol-6]
[pBX, rol-6, pT05G5.1::K04G2.9ORF::GFP]
Summary[K04G2.9::GFP + pha-1(+) + rol-6]
Driven_by_geneWBGene00011498
GeneWBGene00010567
Fusion_reporterGFP
Construction_summaryClone = pDM934. Constructs were generated using the Gateway destination vector (pDM#834) as follows: an 1,878 bp promoter region upstream of T05G5.1 was amplified from wild type (N2) genomic DNA using primers T05G5.1-Fo-Hind, TACTTAAGCTTTTCCTATCTCCG-3 and T05G5.1-Re-XmaI, TCCCCCGGGGCCTGAAGATAAGTGTGAA, and then inserted between the HindIII and XmaI sites of the GFP-encoding vector pPD95.75 from the Fire Lab Vector Kit (Addgene.org) to generate pDM#823. A second PCR fragment containing the attR sites and the ccdB gene from the pDEST24 destination vector (nucleotides 70-961777; Invitrogen) was amplified and cloned into p#DM823 between the MscI and KpnI cloning sites to generate pDM#834.This plasmid was transformed into the E. coli strain DB3.1 (Invitrogen), which is tolerant for the ccdB selectable marker gene. Entry clones were obtained from the ORFeome project (Open Biosystems) and cloned into the destination vector pDM#834 using the gateway strategy with LR clonase (Invitrogen) to make the pT05G5.1::ORF::GFP expression clones.
Used_forTransgene_constructWBTransgene00014376
ReferenceWBPaper00038444