WormBase Tree Display for Construct: WBCnstr00010420
expand all nodes | collapse all nodes | view schema
| WBCnstr00010420 | Other_name | Expr1733_Ex | |
|---|---|---|---|
| Summary | [mif-2::gfp] | ||
| Driven_by_gene | WBGene00003235 | ||
| Gene | WBGene00003235 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | [mif-2::gfp] translational fusion. The cosmid C52E4 as template, Ce-mif-2 5' primer W5278(5' GGCGCGCCTAATCCTAAAGCTGTAAGTATCTG 3') and Ce-mif-2 3' primer W5279(5' ATAAGAATGCGGCCGCTTTCTTATTTGCTTCGGCGACAG 3') were used in a long-range PCR amplification (Boehringer Mannheim) of a 6.5 kb genomic fragment that contained 5 kb of 5' UTR of Ce-mif-2. The PCR primers contained restriction sites to allow directional subcloning into pPD114.108. After cutting the insert and vector with Asc I and Not I, the 6.5 kb genomic fragment was ligated into pPD114.108 to create an in-frame fusion between the 3' end of Ce-mif-2 exon 5 and the ORF of gfp resulting in the production of a Ce-MIF-2-GFP fusion protein. --precise ends. | ||
| Clone | pPD114.108 | ||
| C52E4 | |||
| Used_for | Transgene_construct | WBTransgene00027657 | |
| Reference | WBPaper00005003 |
