WormBase Tree Display for Antibody: WBAntibody00002085
expand all nodes | collapse all nodes | view schema
WBAntibody00002085 | Summary | Rabbit polyclonal antibody against CDC-25.1 recombinant protein. | ||
---|---|---|---|---|
Public_name | [WBPaper00035573]:cdc-25.1 | |||
Gene | WBGene00000386 | |||
Isolation | Original_publication | WBPaper00035573 | ||
Clonality | Polyclonal | |||
Antigen | Protein | HIS-6::CDC-25.1. A1815 bp cDNA sequence of cdc-25.1 with the oligonucleotides: 5'TTTTGGATCCGCTACCACCGGGGAAAAAGC3', 5'TTTTGAGCTCTTATTCGGCGTCGTCAGAAAT3'. | ||
Animal | Rabbit | |||
Expr_pattern | Expr12834 | |||
Reference | WBPaper00035573 |