WormBase Tree Display for Antibody: WBAntibody00000380
expand all nodes | collapse all nodes | view schema
| WBAntibody00000380 | Summary | Rabbit polyclonal antibody against recombinant protein. | ||
|---|---|---|---|---|
| Public_name | [cgc4736]:hcp-4 | |||
| Gene | WBGene00001832 | |||
| Isolation | Original_publication | WBPaper00004736 | ||
| Location | TH | |||
| Clonality | Polyclonal | |||
| Antigen | Protein | To make GST fusion proteins to generate antibodies CeCENP-C/HCP-4 (cgcgcgggatccacgattgttcctggtcgaaa, gcgcgcgaattctcatctctcctcgagaatggttgg), the primers in parentheses were used to amplify fragments of the corresponding genes from cDNAs. Fragments were digested with BamHI-EcoRI (CeCENP-A) and cloned into pGEX6P-1 (Amersham Pharmacia Biotech). Purified GST fusions were injected into rabbits. Affinity purification was performed using standard procedures. | ||
| Animal | Rabbit | |||
| Expr_pattern | Expr1356 | |||
| Reference | WBPaper00004736 | |||
| WBPaper00064062 | ||||
| WBPaper00065285 |
