WormBase Tree Display for Oligo: mv_C53A5.3_f
expand all nodes | collapse all nodes | view schema
mv_C53A5.3_f | Sequence | TGAACTCAAACGGCCCGTTGAT |
---|---|---|
Length | 22 | |
PCR_product | mv_C53A5.3 |
General
People
Want to know more about worm research?
Start here to access information about the species and data available at WormBase [Read more]
Latest updates
Need help?
Get Started
General Search
By Sequence
By Object
By Literature
Data Mining and Batch Queries
For Parasites
For Developers
Top 3 most used tools
Need help?
Get Started
Tools
Commonly requested data
Need help?
External links
We've created different user guides for distinct interests and experience levels [Read more]
Still have questions?
Please use our most recent publication to cite WormBase. Your citation is critical for ensuring the continued development of WormBase! [Read more]
expand all nodes | collapse all nodes | view schema
mv_C53A5.3_f | Sequence | TGAACTCAAACGGCCCGTTGAT |
---|---|---|
Length | 22 | |
PCR_product | mv_C53A5.3 |