WormBase Tree Display for Feature: WBsf977350
expand all nodes | collapse all nodes | view schema
WBsf977350 | SMap | S_parent | Sequence | C53A5 | |
---|---|---|---|---|---|
Name | Public_name | GLD-1 binding site | |||
Sequence_details | Flanking_sequences | atcctttacccgttttgcacttcctcaaca | tcctcacatccacatctaatctaccccctt | ||
Mapping_target | C53A5 | ||||
DNA_text | tccttac | ||||
Origin | Species | Caenorhabditis elegans | |||
Visible (2) | |||||
Defined_by | Defined_by_paper | WBPaper00040521 | Curator_confirmed | WBPerson4025 | |
Associations | Associated_with_gene | WBGene00001834 | |||
Bound_by_product_of | WBGene00001595 | ||||
Remark | Added this GLD-1 binding site as a 'binding_site'. It might be better to change this in future to 'translation_regulatory_region' or 'nucleotide_to_protein_binding_site'. | Curator_confirmed | WBPerson4025 | ||
Method | binding_site |