WormBase Tree Display for Variation: WBVar00600715
expand all nodes | collapse all nodes | view schema
| WBVar00600715 | Evidence | Paper_evidence | WBPaper00039866 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ox175 | |||||
| Sequence_details | SMap | S_parent | Sequence | Y39B6A | |||
| Flanking_sequences | gcttatcaactagtgattatcaatgggata | taactaataatcggaacaatcgcagtcgga | |||||
| Mapping_target | Y39B6A | ||||||
| Type_of_mutation | Insertion | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Transposon_insertion | Mos1 | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | EG | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00012673 | |||||
| Transcript | Y39B6A.11.1 | ||||||
| Description | Phenotype | WBPhenotype:0000249 | Paper_evidence | WBPaper00039866 | |||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000615 | Paper_evidence | WBPaper00039866 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals contained distinctly shorter cilia than in corresponding wild-type control animals. | Paper_evidence | WBPaper00039866 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0002535 | Paper_evidence | WBPaper00039866 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | This mutant strain caused a modestly penetrant dye-filling defective (Dyf) phenotype. | ox175 mutant worms are unable to absorb the fluorescent dye DiI. | Paper_evidence | WBPaper00039866 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00039866 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | The localization of the anterograde IFT motor proteins, and localization patterns of several ciliary membrane proteins, appeared unaltered in the short dyf-17 mutant cilia. | Paper_evidence | WBPaper00039866 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00039866 | ||||||
| Method | Mos_insertion |
