WormBase Tree Display for Variation: WBVar00143789
expand all nodes | collapse all nodes | view schema
| WBVar00143789 | Evidence | Paper_evidence | WBPaper00041308 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e1162 | |||||
| Other_name | CE45344:p.Ala347GlyfsTer11 | ||||||
| C27H6.1a.1:c.1038dup | |||||||
| CE45373:p.Ala65GlyfsTer11 | |||||||
| C27H6.1b.1:c.192dup | |||||||
| HGVSg | CHROMOSOME_V:g.9972073dup | ||||||
| Sequence_details | SMap | S_parent | Sequence | C27H6 | |||
| Flanking_sequences | ATAACATCACCAGATGCACCACACCAAGGG | GTAAGTAAGCTCATTTCTTTCGTTTCGGTT | |||||
| Mapping_target | C27H6 | ||||||
| Type_of_mutation | Insertion | g | Paper_evidence | WBPaper00041308 | |||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006777 | |||||
| Transcript | C27H6.1b.1 | VEP_consequence | frameshift_variant,splice_region_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | C27H6.1b.1:c.192dup | ||||||
| HGVSp | CE45373:p.Ala65GlyfsTer11 | ||||||
| cDNA_position | 192-193 | ||||||
| CDS_position | 192-193 | ||||||
| Protein_position | 64-65 | ||||||
| Codon_change | -/G | ||||||
| Amino_acid_change | -/X | ||||||
| C27H6.1a.1 | VEP_consequence | frameshift_variant,splice_region_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | C27H6.1a.1:c.1038dup | ||||||
| HGVSp | CE45344:p.Ala347GlyfsTer11 | ||||||
| cDNA_position | 1050-1051 | ||||||
| CDS_position | 1038-1039 | ||||||
| Protein_position | 346-347 | ||||||
| Codon_change | -/G | ||||||
| Amino_acid_change | -/X | ||||||
| Genetics | Gene_class | unc | |||||
| Interpolated_map_position | V | 2.2235 | |||||
| Description | Phenotype | WBPhenotype:0000319 | Person_evidence | WBPerson261 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | larger size, sd Unc phenotype. | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000643 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Unc | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Phenotype_not_observed | WBPhenotype:0000507 | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | normal acetylcholine levels, larger size, sd Unc phenotype. | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Semi_dominant | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00041308 | ||||||
| WBPaper00002007 | |||||||
| WBPaper00014640 | |||||||
| WBPaper00061430 | |||||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
| Created by WBPerson1983 from the NN_VFP_triage_pipeline | |||||||
| Method | Insertion_allele |
