WormBase Tree Display for Variation: WBVar00143087
expand all nodes | collapse all nodes | view schema
WBVar00143087 | Name | Public_name | e286 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F30H5.1.1:c.2464C>T | |||||||
CE01925:p.Leu822Phe | ||||||||
HGVSg | CHROMOSOME_III:g.500483C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F30H5 | ||||
Flanking_sequences | ccattttcagcccggaaccgatcgtctgaaa | tctgggttctctactcggcagaagttgaaga | ||||||
Mapping_target | F30H5 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003295 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004142 | |||||||
WBStrain00006360 | ||||||||
WBStrain00026328 | ||||||||
WBStrain00033497 | ||||||||
WBStrain00033521 | ||||||||
WBStrain00034257 | ||||||||
WBStrain00035413 | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006781 | ||||||
Transcript | F30H5.1.1 (12) | |||||||
Interactor | WBInteraction000534891 | |||||||
WBInteraction000534893 | ||||||||
WBInteraction000534895 | ||||||||
WBInteraction000534897 | ||||||||
WBInteraction000560388 | ||||||||
Isolation | Mutagen | hydroxylamine | ||||||
Genetics | Interpolated_map_position | III | -26.82 | |||||
Mapping_data | In_2_point | 50 | ||||||
623 | ||||||||
6052 | ||||||||
In_multi_point | 67 | |||||||
856 | ||||||||
857 | ||||||||
1580 | ||||||||
1628 | ||||||||
1630 | ||||||||
1632 | ||||||||
2337 | ||||||||
2338 | ||||||||
3291 | ||||||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0000518 | Paper_evidence | WBPaper00046852 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "A single amino acid substitute in the UCS domain of C-elegans UNC-45, E781K, or L822F (the m94 and e286 alleles, respectively), results in temperature-sensitive motility defects (Figure 1B) and myosin disorganization phenotypes (Figure 1C) when animals are grown at restrictive conditions (>22 degrees Celsius). However, animals show no phenotypes during development and early adulthood when grown at the permissive temperature (15 degrees Celsius C)." | Paper_evidence | WBPaper00046852 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00046852 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00046852 | ||||||
Curator_confirmed | WBPerson5063 | |||||||
Remark | At 15C animals are WT on control RNAi but are fully paralyzed on daf-21, C01G10.8, sti-1 or ZC395.10 RNAi. WT animals do not show paralysis when treated with these RNAi. | Paper_evidence | WBPaper00046852 | |||||
Curator_confirmed | WBPerson5063 | |||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00046852 | ||||
Curator_confirmed | WBPerson5063 | |||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference (12) | ||||||||
Method | Substitution_allele |