WormBase Tree Display for Variation: WBVar00143078
expand all nodes | collapse all nodes | view schema
| WBVar00143078 | Evidence | Paper_evidence | WBPaper00041162 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | e271 | |||||||
| Other_name | CE25115:p.Arg824Ter | ||||||||
| T19B4.7.1:c.2470C>T | |||||||||
| HGVSg | CHROMOSOME_I:g.5683473G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | T19B4 | |||||
| Flanking_sequences | ggatctggatttccgatttatgagactgtc | gaacattgtctcgtgaaactccatcacatt | |||||||
| Mapping_target | T19B4 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00041162 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00003970 | ||||||||
| WBStrain00003972 | |||||||||
| WBStrain00004141 | |||||||||
| Laboratory | CB | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006776 | |||||||
| Transcript | T19B4.7.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | T19B4.7.1:c.2470C>T | ||||||||
| HGVSp | CE25115:p.Arg824Ter | ||||||||
| cDNA_position | 2533 | ||||||||
| CDS_position | 2470 | ||||||||
| Protein_position | 824 | ||||||||
| Exon_number | 13/19 | ||||||||
| Codon_change | Cga/Tga | ||||||||
| Amino_acid_change | R/* | ||||||||
| Interactor (16) | |||||||||
| Genetics | Interpolated_map_position | I | 0.308522 | ||||||
| Mapping_data | In_2_point | 26 | |||||||
| In_multi_point | 15 | ||||||||
| 973 | |||||||||
| 974 | |||||||||
| 992 | |||||||||
| 1372 | |||||||||
| 1373 | |||||||||
| 1374 | |||||||||
| 1375 | |||||||||
| In_pos_neg_data (30) | |||||||||
| Description | Phenotype (18) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000104 | Paper_evidence | WBPaper00035117 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | INA-1/PAT-3::GFP was localized normally in unc-40(e271) mutant animals | Paper_evidence | WBPaper00035117 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Mutation did not cause SNB-1::VENUS localization defects. | Paper_evidence | WBPaper00040857 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000679 | Paper_evidence | WBPaper00036484 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | MADD-2::GFP was excluded from the dorsal ADL branch and was present at high levels in the cell body, a pattern that was also observed in control animals. | Paper_evidence | WBPaper00036484 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00036484 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| Reference (15) | |||||||||
| Method | Substitution_allele |
