WormBase Tree Display for Variation: WBVar00143011
expand all nodes | collapse all nodes | view schema
| WBVar00143011 | Evidence | Paper_evidence | WBPaper00030788 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e177 | |||||
| Other_name | CE27791:p.Trp124Ter | ||||||
| C04F5.3.1:c.372G>A | |||||||
| HGVSg | CHROMOSOME_V:g.5098362C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | C04F5 | |||
| Flanking_sequences | gcgtgcaaagcgccttgatgaattgagatg | caattgaacaaagtgatctacgaggaaaaa | |||||
| Mapping_target | C04F5 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00030788 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain (163) | |||||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006782 | |||||
| Transcript | C04F5.3.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | C04F5.3.1:c.372G>A | ||||||
| HGVSp | CE27791:p.Trp124Ter | ||||||
| cDNA_position | 494 | ||||||
| CDS_position | 372 | ||||||
| Protein_position | 124 | ||||||
| Exon_number | 5/9 | ||||||
| Codon_change | tgG/tgA | ||||||
| Amino_acid_change | W/* | ||||||
| Genetics | Interpolated_map_position | V | -2.51992 | ||||
| Mapping_data | In_2_point (27) | ||||||
| In_multi_point (24) | |||||||
| In_pos_neg_data | 845 | ||||||
| 2134 | |||||||
| 3076 | |||||||
| 3259 | |||||||
| Description | Phenotype | WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | slightly small | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000563 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | shrinker contracts both dorsally and ventrally when prodded | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||
| WBPaper00001474 | |||||||
| Curator_confirmed | WBPerson48 | ||||||
| WBPerson712 | |||||||
| Remark | Unc | Paper_evidence | WBPaper00001474 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | slow, good forward movement | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001005 | Person_evidence | WBPerson261 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | poor backing | Person_evidence | WBPerson261 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00029020 | ||||||
| WBPaper00001474 | |||||||
| WBPaper00000031 | |||||||
| WBPaper00014148 | |||||||
| WBPaper00022021 | |||||||
| WBPaper00025822 | |||||||
| Remark | Site of e177 lesion was estimated from figure 1; actual coordinates are not provided in the paper. | Paper_evidence | WBPaper00030788 | ||||
| Method | Substitution_allele |
